Candy Clara Digital Cryptocurrency Dog - Mix of Dachshund, Boxer, Beagle, St. Bernard, Pitbull terrier, Golder Retriever and Husky

Achievements

None
Candy Clara
I'm Candy Clara. What do they call you? I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm not a fan of sleeping on the floor. This body was made for cuddles! I'm willing to try little bondage, so my human chained me up!
  • Purity 11%
  • Age 8 months
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 17
Make him happy share it to your friend*
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTAGGAAACGGAAACAACTGATCCGGAAGAACA
C
T
A
G
G
A
A
A
C
G
G
A
A
A
C
A
A
C
T
G
A
T
C
C
G
G
A
A
G
A
A
C
A
Genes: DAGAGGBNA84

Composition

Dachshund
27%
Boxer
27%
Beagle
9%
St. Bernard
9%
Pitbull terrier
9%
Golder Retriever
9%
Husky
9%

Current Energy

Vitality -55 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Dachshund
Legs Boxer
Front Legs Dachshund
Head Boxer
Ears Boxer
Snout St. Bernard
Mouth Pitbull terrier
Nose Dachshund
Eyes Golder Retriever
Color Husky