Candy Clara Digital Cryptocurrency Dog - Mix of Dachshund, Boxer, Beagle, St. Bernard, Pitbull terrier, Golder Retriever and Husky
Candy Clara
  • Purity 11%
  • Age 37 months
  • Racing Exp 16
  • Dachshund 27%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 4 races
  • Gen 17
Sad & Snaillike

Achievements

Racer

Bio

I'm Candy Clara. What do they call you? I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I'm not a fan of sleeping on the floor. This body was made for cuddles! I'm willing to try little bondage, so my human chained me up!

Racing Stats

Ran 4 races
  • 0 2 0
 Best Time15.72 sec
No rank  RacingĀ *** Pts
50.0% wins (2) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTAGGAAACGGAAACAACTGATCCGGAAGAACA
C
T
A
G
G
A
A
A
C
G
G
A
A
A
C
A
A
C
T
G
A
T
C
C
G
G
A
A
G
A
A
C
A
Genes: DAGAGGBNA84

Composition

Dachshund
27%
Boxer
27%
Beagle
9%
St. Bernard
9%
Pitbull terrier
9%
Golder Retriever
9%
Husky
9%

Current Energy

Vitality -55 points
Lunar Effect +4 points

Traits Breakdown

Body Beagle
Tail Dachshund
Legs Boxer
Front Legs Dachshund
Head Boxer
Ears Boxer
Snout St. Bernard
Mouth Pitbull terrier
Nose Dachshund
Eyes Golder Retriever
Color Husky