Frank West Furball Crypto Game Dog - Mix of Dachshund, Labrador, St. Bernard, Beagle, Boxer and Husky

Achievements

Racer
Frank West Furball
Hi, I'm Frank West Furball. Once I caught a seagull, but it scared me so I let it go. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I enjoy exploration and am game for anything doggy-style. I don't like running outta pee when there are still so many trees.
  • Purity 10%
  • Age 3 months
  • Racing Exp 47
  • Dachshund 27%
  • 8 races
  • Gen 18
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 3 3 0
 Best Time15.93 sec
No rank  Racing *** Pts
75.0 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGGACCAGGACCAAACTGACCAGGATGAACA
C
T
A
G
G
A
C
C
A
G
G
A
C
C
A
A
A
C
T
G
A
C
C
A
G
G
A
T
G
A
A
C
A
Genes: DA5A5GB5AB4

Composition

Dachshund
27%
Labrador
27%
St. Bernard
18%
Beagle
9%
Boxer
9%
Husky
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Dachshund
Legs Labrador
Front Legs Dachshund
Head Labrador
Ears Boxer
Snout St. Bernard
Mouth Labrador
Nose Dachshund
Eyes St. Bernard
Color Husky