Frank West Furball Crypto Game Dog - Mix of Dachshund, Labrador, St. Bernard, Beagle, Boxer and Husky
Frank West Furball
  • Purity 10%
  • Age 26 days
  • Racing Exp 0
  • Dachshund 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 18
Sad & Tardy

Achievements

None

Bio

Hi, I'm Frank West Furball. Once I caught a seagull, but it scared me so I let it go. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I enjoy exploration and am game for anything doggy-style. I don't like running outta pee when there are still so many trees.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTAGGACCAGGACCAAACTGACCAGGATGAACA
C
T
A
G
G
A
C
C
A
G
G
A
C
C
A
A
A
C
T
G
A
C
C
A
G
G
A
T
G
A
A
C
A
Genes: DA5A5GB5AB4

Composition

Dachshund
27%
Labrador
27%
St. Bernard
18%
Beagle
9%
Boxer
9%
Husky
9%

Current Energy

Vitality +22 points
Lunar Effect -4 points

Traits Breakdown

Body Beagle
Tail Dachshund
Legs Labrador
Front Legs Dachshund
Head Labrador
Ears Boxer
Snout St. Bernard
Mouth Labrador
Nose Dachshund
Eyes St. Bernard
Color Husky

Parents

No Children

Gift