Noob Saibot Ned Crypto Dog - Mix of Pug, Border Collie and Labrador

Achievements

Racer
Noob Saibot Ned
Sup? ;-) I'm Noob Saibot Ned. Hope you like the smell of wet fur, because I'll jump into any water I see! I don't like it when my bowl is empty, so I take it to my human and it magically refills! They say my bite is worse than my bark. I love cuddling up, doggy-style after a romantic evening.
  • Purity 67%
  • Age 5 months
  • Racing Exp 1
  • Pug 82%
  • 1 races
  • Gen 19
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time18.33 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAATACCCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
C
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222J5222222

Composition

Pug
82%
Border Collie
9%
Labrador
9%

Current Energy

Vitality -52 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug