Noob Saibot Ned Crypto Dog - Mix of Pug, Border Collie and Labrador
Noob Saibot Ned
  • Purity 67%
  • Age 31 days
  • Racing Exp 13
  • Pug 82%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 6 races
  • Gen 19
Sad & Slothful

Achievements

Racer

Bio

Sup? ;-) I'm Noob Saibot Ned. Hope you like the smell of wet fur, because I'll jump into any water I see! I don't like it when my bowl is empty, so I take it to my human and it magically refills! They say my bite is worse than my bark. I love cuddling up, doggy-style after a romantic evening.

Racing Stats

Ran 6 races
  • 1 0 0
 Best Time15.78 sec
No rank  RacingĀ *** Pts
16.7 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATACCCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
T
A
C
C
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222J5222222

Composition

Pug
82%
Border Collie
9%
Labrador
9%

Current Energy

Vitality +2 points
Lunar Effect -4 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug

Parents

No Children

Photos

online doggy racing
Gift