Armanti Acadia Litecoin Dog - Mix of Dachshund, Pitbull terrier, Poodle, Golder Retriever, German Shepard, Labrador, Rottweiler and Yorkshire Terrier

Achievements

Racer
Podium Champion
Armanti Acadia
How YOU doin'? Armanti Acadia here. I hate bubble baths; mud puddles are more my style. Removing excess stuffing from pillows is my favorite hobby. I enjoy going to the dog park to see all my friends! I'll lick anything.
  • Purity 8%
  • Age 21 months
  • Racing Exp 21
  • Dachshund 27%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 1
3 races    Best Time16.25 sec
No rank  Racing *** Coins
100.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGACAGAGGATCAGGAGGATCCCCACACTTA
T
C
C
G
A
C
A
G
A
G
G
A
T
C
A
G
G
A
G
G
A
T
C
C
C
C
A
C
A
C
T
T
A
Genes: NI8A7AAN5HF

Composition

Dachshund
27%
Pitbull terrier
18%
Poodle
9%
Golder Retriever
9%
German Shepard
9%
Labrador
9%
Rottweiler
9%
Yorkshire Terrier
9%

Current Energy

Vitality -25 points
Lunar Effect +6 points

Traits Breakdown

Body Pitbull terrier
Tail Poodle
Legs Golder Retriever
Front Legs Dachshund
Head German Shepard
Ears Dachshund
Snout Dachshund
Mouth Pitbull terrier
Nose Labrador
Eyes Rottweiler
Color Yorkshire Terrier