Armanti Acadia Litecoin Dog - Mix of Dachshund, Pitbull terrier, Poodle, Golder Retriever, German Shepard, Labrador, Rottweiler and Yorkshire Terrier
Armanti Acadia
  • Purity 8%
  • Age 17 months
  • Racing Exp 38
  • Dachshund 27%
  • Gold medal 2 Silver medal 1 Bronze medal 2
  • 8 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion
TOP 10 Fastest

Bio

How YOU doin'? Armanti Acadia here. I hate bubble baths; mud puddles are more my style. Removing excess stuffing from pillows is my favorite hobby. I enjoy going to the dog park to see all my friends! I'll lick anything.

Racing Stats

Ran 8 races
  • 2 1 2
 Best Time15.37 sec
Rank 5  RacingĀ *** Pts
62.5 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCCGACAGAGGATCAGGAGGATCCCCACACTTA
T
C
C
G
A
C
A
G
A
G
G
A
T
C
A
G
G
A
G
G
A
T
C
C
C
C
A
C
A
C
T
T
A
Genes: NI8A7AAN5HF

Composition

Dachshund
27%
Pitbull terrier
18%
Poodle
9%
Golder Retriever
9%
German Shepard
9%
Labrador
9%
Rottweiler
9%
Yorkshire Terrier
9%

Current Energy

Vitality -25 points
Lunar Effect +8 points

Traits Breakdown

Body Pitbull terrier
Tail Poodle
Legs Golder Retriever
Front Legs Dachshund
Head German Shepard
Ears Dachshund
Snout Dachshund
Mouth Pitbull terrier
Nose Labrador
Eyes Rottweiler
Color Yorkshire Terrier