Buffy Boots Cryptocurrency Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Podium Champion
Pro Racer
Master Champion
Buffy Boots
Suh...you good? Buffy Boots here. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I am a proud show dog. I like showing off my perfect coat! I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I'm looking to share time together and not just to be an accessory.
  • Purity 65%
  • Age 21 months
  • Racing Exp 226
  • Dachshund 82%
  • 55 races
  • Gen 16
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 11 9 8
55 races    Best Time14.53 sec
No rank  Racing *** Coins
50.9 % wins (28) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund