Buffy Boots Cryptocurrency Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Buffy Boots
  • Purity 65%
  • Age 17 months
  • Racing Exp 229
  • Dachshund 82%
  • Gold medal 11 Silver medal 9 Bronze medal 8
  • 58 races
  • Gen 16
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

Suh...you good? Buffy Boots here. I'd like to leave my paw prints in the sand next to yours on a moonlit beach. I am a proud show dog. I like showing off my perfect coat! I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery! I'm looking to share time together and not just to be an accessory.

Racing Stats

Ran 58 races
  • 11 9 8
 Best Time14.53 sec
No rank  RacingĀ *** Pts
48.3 % wins (28) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund