Tocokki Taylor Crypto Game Dog - Mix of Dachshund, Pug, Husky, Shiba Inu, Golder Retriever and French Bulldog
Tocokki Taylor
  • Purity 23%
  • Age 13 months
  • Racing Exp 8
  • Dachshund 45%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 17
Depressed & Snaillike

Achievements

Racer

Bio

Hello, I'm Tocokki Taylor. How's it goin'? My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not into dog collars, unless you're into S & M.

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time15.73 sec
Rank 85  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAACAGTAGAAGAAGGAGGAAGACGA
G
G
A
G
G
A
G
G
A
A
C
A
G
T
A
G
A
A
G
A
A
G
G
A
G
G
A
A
G
A
C
G
A
Genes: AAA4E22AA89

Composition

Dachshund
45%
Pug
18%
Husky
9%
Shiba Inu
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pug
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color French Bulldog

Parents

No Children

Photos

online pet race photo
Gift