Tocokki Taylor Crypto Game Dog - Mix of Dachshund, Pug, Husky, Shiba Inu, Golder Retriever and French Bulldog

Achievements

Racer
Tocokki Taylor
Hello, I'm Tocokki Taylor. How's it goin'? My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not into dog collars, unless you're into S & M.
  • Purity 23%
  • Age 21 months
  • Racing Exp 20
  • Dachshund 45%
  • 7 races
  • Gen 17
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
7 races    Best Time15.57 sec
No rank  Racing *** Coins
28.6 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAACAGTAGAAGAAGGAGGAAGACGA
G
G
A
G
G
A
G
G
A
A
C
A
G
T
A
G
A
A
G
A
A
G
G
A
G
G
A
A
G
A
C
G
A
Genes: AAA4E22AA89

Composition

Dachshund
45%
Pug
18%
Husky
9%
Shiba Inu
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pug
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color French Bulldog