Tocokki Taylor Crypto Game Dog - Mix of Dachshund, Pug, Husky, Shiba Inu, Golder Retriever and French Bulldog

Achievements

Racer
Podium Champion
Tocokki Taylor
Hello, I'm Tocokki Taylor. How's it goin'? My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I like to eat. Anything and everything. Old or new. My stomach doesn't discriminate! I'm not into dog collars, unless you're into S & M.
  • Purity 23%
  • Age 18 months
  • Racing Exp 57
  • Dachshund 45%
  • 27 races
  • Gen 17
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

27 races   |
  • 2 1 2
 Best Time14.78 sec
No rank  Racing *** Pts
18.5 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAACAGTAGAAGAAGGAGGAAGACGA
G
G
A
G
G
A
G
G
A
A
C
A
G
T
A
G
A
A
G
A
A
G
G
A
G
G
A
A
G
A
C
G
A
Genes: AAA4E22AA89

Composition

Dachshund
45%
Pug
18%
Husky
9%
Shiba Inu
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality -33 points
Lunar Effect -20 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pug
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color French Bulldog

Parents

No Children

Photos

online dog racing virtual dog race results online canine racing results Litecoin pet racing photo online canine racing results