Rowdy Rose Crypto Dog - Mix of Pug, Labrador BK, Labrador, Poodle, Husky, Shiba Inu, St. Bernard, Grey Wolf, Border Collie and French Bulldog

Achievements

Pro Racer
Podium Champion
Master Champion
Rowdy Rose
I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. I never knew my father. Peanut butter is delish but I HATE when it sticks to the roof of my mouth. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I just want to "share a bone"... ;)
  • Purity 3%
  • Age 39 months
  • Racing Exp 130
  • Pug 18%
  • 25 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

25 races   |
  • 7 6 4
 Best Time15.32 sec
Rank 81  Racing *** Pts
68.0 % wins (17) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCACCAGACACAGTAGAAGAATGACCCTACCGA
G
C
A
C
C
A
G
A
C
A
C
A
G
T
A
G
A
A
G
A
A
T
G
A
C
C
C
T
A
C
C
G
A
Genes: 65I4E22BLJ9

Composition

Pug
18%
Labrador BK
9%
Labrador
9%
Poodle
9%
Husky
9%
Shiba Inu
9%
St. Bernard
9%
Grey Wolf
9%
Border Collie
9%
French Bulldog
9%

Current Energy

Vitality -14 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Labrador
Legs Poodle
Front Legs Husky
Head Shiba Inu
Ears Pug
Snout Pug
Mouth St. Bernard
Nose Grey Wolf
Eyes Border Collie
Color French Bulldog