Pongo Pookie Crypto Dog - Mix of Dachshund, German Shepard, St. Bernard and Golder Retriever
Pongo Pookie
  • Purity 50%
  • Age 14 months
  • Racing Exp 16
  • Dachshund 73%
  • Gold medal 1 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Pongo Pookie here, let's shake. Little Bow Wow is my favorite musician. I just assume he's a dog... I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! I pee when I'm excited. I hate it when my human runs out of poop-bags. How embarrassing!

Racing Stats

Ran 3 races
  • 1 1 0
 Best Time14.95 sec
Rank 14  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAGGAGGAGGAGGAGGATGAGGAGGAAGAGGA
T
C
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: 7AAAAABAA8A

Composition

Dachshund
73%
German Shepard
9%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund