Zena Zane Bitcoin Dog - Mix of Grey Wolf, Dachshund, Rottweiler, German Shepard, Golder Retriever, Labrador and Labrador BK
Zena Zane
  • Purity 7%
  • Age 16 months
  • Racing Exp 9
  • Grey Wolf 27%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

A-yo...Call me Zena Zane. Virtually, I'll come whenever you call. What's your favorite bed? Mine is the dirty laundry. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I want someone who can show me a good time; I'll do the same for you.

Racing Stats

Ran 3 races
  • 0 1 0
 Best Time14.45 sec
Rank 5  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAGGACCCCACCCCGGAAGACACCCACCCGCA
T
C
A
G
G
A
C
C
C
C
A
C
C
C
C
G
G
A
A
G
A
C
A
C
C
C
A
C
C
C
G
C
A
Genes: 7ALHLA8H5L6

Composition

Grey Wolf
27%
Dachshund
18%
Rottweiler
18%
German Shepard
9%
Golder Retriever
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -13 points
Lunar Effect -18 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Grey Wolf
Front Legs Rottweiler
Head Grey Wolf
Ears Dachshund
Snout Golder Retriever
Mouth Rottweiler
Nose Labrador
Eyes Grey Wolf
Color Labrador BK