Taffy Taylor Crypto Dog - Mix of Corgi, St. Bernard and French Bulldog

Achievements

Racer
Podium Champion
Taffy Taylor
I live behind a firewall in the Machine. I'm going kill that damn Nyan Cat if I can catch it. I like to smell everything, but my favorite smell is freshly cut grass. I like to roll in it until my fur turns green! I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized.
  • Purity 44%
  • Age 41 months
  • Racing Exp 66
  • Corgi 45%
  • 23 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 6
23 races    Best Time15.82 sec
No rank  Racing *** Coins
34.8 % wins (8) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AGCAGCAGCAGCAGCTGATGATGATGATGACGA
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
T
G
A
T
G
A
T
G
A
T
G
A
T
G
A
C
G
A
Genes: OOOOOBBBBB9

Composition

Corgi
45%
St. Bernard
45%
French Bulldog
9%

Current Energy

Vitality -40 points
Lunar Effect -12 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears St. Bernard
Snout St. Bernard
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color French Bulldog