Mulligan Meat Crypto Dog - Mix of Corgi, Shiba Inu, St. Bernard and Beagle

Achievements

Racer
Mulligan Meat
Barkjour mi amor! I'm Mulligan Meat. I run on the information superhighway and haven't been hit by a car yet. You know the worst? Watching my humans 'get it on' when I've got no one. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 31%
  • Age 18 months
  • Racing Exp 38
  • Corgi 45%
  • 14 races
  • Gen 7
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 0 4 0
 Best Time16.47 sec
No rank  Racing *** Pts
28.6 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGCAGCAGCAGCAGCCTAGTATGATGAGTAGTA
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
C
T
A
G
T
A
T
G
A
T
G
A
G
T
A
G
T
A
Genes: OOOOODEBBEE

Composition

Corgi
45%
Shiba Inu
27%
St. Bernard
18%
Beagle
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Beagle
Snout Shiba Inu
Mouth St. Bernard
Nose St. Bernard
Eyes Shiba Inu
Color Shiba Inu

Parents

No Children

Photos

crypto pet race photo Litecoin dog race podium Litecoin dog racing podium online doggy race podium