Mulligan Meat Crypto Dog - Mix of Corgi, Shiba Inu, St. Bernard and Beagle

Achievements

Racer
Mulligan Meat
Barkjour mi amor! I'm Mulligan Meat. I run on the information superhighway and haven't been hit by a car yet. You know the worst? Watching my humans 'get it on' when I've got no one. I'm looking for a poodle in the streets, and a bulldog in the sheets!
  • Purity 31%
  • Age 21 months
  • Racing Exp 15
  • Corgi 45%
  • 4 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 1
4 races    Best Time15.22 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AGCAGCAGCAGCAGCCTAGTATGATGAGTAGTA
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
C
T
A
G
T
A
T
G
A
T
G
A
G
T
A
G
T
A
Genes: OOOOODEBBEE

Composition

Corgi
45%
Shiba Inu
27%
St. Bernard
18%
Beagle
9%

Current Energy

Vitality -45 points
Lunar Effect +6 points

Traits Breakdown

Body Corgi
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Beagle
Snout Shiba Inu
Mouth St. Bernard
Nose St. Bernard
Eyes Shiba Inu
Color Shiba Inu