Perdita Prelude Bitcoin Dog - Mix of Corgi, German Shepard, St. Bernard, Boxer, French Bulldog and Border Collie

Achievements

Podium Champion
Pro Racer
Master Champion
Perdita Prelude
As a digital dog, let me say Bob Dole did not invent the internet. My favorite way to spend playtime is a good game of frisbee. Don't bother contacting me if you like cats. I like to work out by digging fresh holes in landscaped yards. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 19%
  • Age 21 months
  • Racing Exp 140
  • Corgi 36%
  • 26 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 6 7 6
26 races    Best Time14.52 sec
No rank  Racing *** Coins
73.1 % wins (19) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAAGCAGCAGCAGCTGAAACCGATGATACTCA
T
C
A
A
G
C
A
G
C
A
G
C
A
G
C
T
G
A
A
A
C
C
G
A
T
G
A
T
A
C
T
C
A
Genes: 7OOOOBG9BJ7

Composition

Corgi
36%
German Shepard
18%
St. Bernard
18%
Boxer
9%
French Bulldog
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect +2 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears St. Bernard
Snout Boxer
Mouth French Bulldog
Nose St. Bernard
Eyes Border Collie
Color German Shepard