Perdita Prelude Bitcoin Dog - Mix of Corgi, German Shepard, St. Bernard, Boxer, French Bulldog and Border Collie
Perdita Prelude
  • Purity 19%
  • Age 18 months
  • Racing Exp 140
  • Corgi 36%
  • Gold medal 6 Silver medal 7 Bronze medal 6
  • 26 races
  • Gen 1
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer
Master Champion

Bio

As a digital dog, let me say Bob Dole did not invent the internet. My favorite way to spend playtime is a good game of frisbee. Don't bother contacting me if you like cats. I like to work out by digging fresh holes in landscaped yards. I'm on the lookout for someone willing to stop and smell the catpoop with me.

Racing Stats

Ran 26 races
  • 6 7 6
 Best Time14.52 sec
No rank  RacingĀ *** Pts
73.1 % wins (19) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAAGCAGCAGCAGCTGAAACCGATGATACTCA
T
C
A
A
G
C
A
G
C
A
G
C
A
G
C
T
G
A
A
A
C
C
G
A
T
G
A
T
A
C
T
C
A
Genes: 7OOOOBG9BJ7

Composition

Corgi
36%
German Shepard
18%
St. Bernard
18%
Boxer
9%
French Bulldog
9%
Border Collie
9%

Current Energy

Vitality -26 points
Lunar Effect +6 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears St. Bernard
Snout Boxer
Mouth French Bulldog
Nose St. Bernard
Eyes Border Collie
Color German Shepard