Kelly Kenzi Digital Cryptocurrency Dog - Mix of Corgi, Border Collie, Labrador BK, French Bulldog, St. Bernard and German Shepard

Achievements

None
Kelly Kenzi
How you doin? ;) Kelly Kenzi here. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I live life by my favorite quote "Every dog has it's day", but every day is my day! If we can run as a pack for a while, I'm open to that.
  • Purity 23%
  • Age 21 months
  • Racing Exp 0
  • Corgi 45%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGCAGCAGCAGCAGCTACCGATGATACTCA
G
C
A
A
G
C
A
G
C
A
G
C
A
G
C
A
G
C
T
A
C
C
G
A
T
G
A
T
A
C
T
C
A
Genes: 6OOOOOJ9BJ7

Composition

Corgi
45%
Border Collie
18%
Labrador BK
9%
French Bulldog
9%
St. Bernard
9%
German Shepard
9%

Current Energy

Vitality -31 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail Corgi
Legs Corgi
Front Legs Corgi
Head Corgi
Ears Corgi
Snout Border Collie
Mouth French Bulldog
Nose St. Bernard
Eyes Border Collie
Color German Shepard