Stryder Skeeter Crypto Game Dog - Mix of Corgi, Labrador BK, Pitbull terrier, Maltese, Border Collie, Labrador and Pug
Stryder Skeeter
  • Purity 12%
  • Age 18 months
  • Racing Exp 98
  • Corgi 36%
  • Gold medal 4 Silver medal 4 Bronze medal 4
  • 26 races
  • Gen 3
Depressed & Snaillike

Achievements

Pro Racer
Podium Champion
Master Champion

Bio

My name is Stryder Skeeter and I do tricks. Baby, I'm made from the same stuff as dreams. Oh, go ahead. Pet me. I know you want to. I hate having to wear foo-foo clothes and ribbons in my fur. My bark alone scares birds out of my yard. Fun-loving and playful only need apply.

Racing Stats

Ran 26 races
  • 4 4 4
 Best Time15.07 sec
No rank  RacingĀ *** Pts
46.2 % wins (12) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAAGCTCCGCAACCAGCTACCCAGAAAGCAGC
G
C
A
A
G
C
T
C
C
G
C
A
A
C
C
A
G
C
T
A
C
C
C
A
G
A
A
A
G
C
A
G
C
Genes: 6ON6KOJ52OO

Composition

Corgi
36%
Labrador BK
18%
Pitbull terrier
9%
Maltese
9%
Border Collie
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -26 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador BK
Tail Corgi
Legs Pitbull terrier
Front Legs Labrador BK
Head Maltese
Ears Corgi
Snout Border Collie
Mouth Labrador
Nose Pug
Eyes Corgi
Color Corgi