Stryder Skeeter Crypto Game Dog - Mix of Corgi, Labrador BK, Pitbull terrier, Maltese, Border Collie, Labrador and Pug

Achievements

Pro Racer
Podium Champion
Master Champion
Stryder Skeeter
My name is Stryder Skeeter and I do tricks. Baby, I'm made from the same stuff as dreams. Oh, go ahead. Pet me. I know you want to. I hate having to wear foo-foo clothes and ribbons in my fur. My bark alone scares birds out of my yard. Fun-loving and playful only need apply.
  • Purity 12%
  • Age 21 months
  • Racing Exp 98
  • Corgi 36%
  • 26 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 4 4 4
26 races    Best Time15.07 sec
No rank  Racing *** Coins
46.2 % wins (12) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAGCTCCGCAACCAGCTACCCAGAAAGCAGC
G
C
A
A
G
C
T
C
C
G
C
A
A
C
C
A
G
C
T
A
C
C
C
A
G
A
A
A
G
C
A
G
C
Genes: 6ON6KOJ52OO

Composition

Corgi
36%
Labrador BK
18%
Pitbull terrier
9%
Maltese
9%
Border Collie
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -26 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Corgi
Legs Pitbull terrier
Front Legs Labrador BK
Head Maltese
Ears Corgi
Snout Border Collie
Mouth Labrador
Nose Pug
Eyes Corgi
Color Corgi