Greta Ginny Bitcoin Game Dog - Mix of Labrador BK, Corgi, Border Collie, German Shepard, Pitbull terrier, Shiba Inu, Labrador and Pug

Achievements

None
Greta Ginny
I am a guard dog for the data warehouse. I'm into chasing fast cars, squirrels and my tail. My favorite treat is to steal the pepperoni off of pizza. It turns me on when I can show an older dog a new trick. I'm hoping to find someone who'll howl at the moon with me.
  • Purity 4%
  • Age 19 months
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATCATCCGCAGTAAGCTACCCAGAATACAGC
G
C
A
T
C
A
T
C
C
G
C
A
G
T
A
A
G
C
T
A
C
C
C
A
G
A
A
T
A
C
A
G
C
Genes: 67N6EOJ52JO

Composition

Labrador BK
18%
Corgi
18%
Border Collie
18%
German Shepard
9%
Pitbull terrier
9%
Shiba Inu
9%
Labrador
9%
Pug
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Pitbull terrier
Front Legs Labrador BK
Head Shiba Inu
Ears Corgi
Snout Border Collie
Mouth Labrador
Nose Pug
Eyes Border Collie
Color Corgi