Niko Bellic Nessie Crypto Game Dog - Mix of German Shepard, Border Collie, Boxer, Corgi, Labrador BK, Rottweiler, French Bulldog and Schnauzer

Achievements

Pro Racer
Podium Champion
Niko Bellic Nessie
Good day to you! I'm Niko Bellic Nessie! I live inside of a web app in a big data center. Too much steak gives me the runs! I think swimming is pretty much the most fun thing ever. Pools, lakes, ponds, even slightly large puddles on the sidewalk! I'm into recreational spankings and a little 'ruff' play.
  • Purity 6%
  • Age 25 months
  • Racing Exp 58
  • German Shepard 18%
  • 13 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

13 races   |
  • 4 2 1
 Best Time15.50 sec
No rank  Racing *** Pts
53.8 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAGCGCATACAACCACAACCGAATATACTCA
T
C
A
A
G
C
G
C
A
T
A
C
A
A
C
C
A
C
A
A
C
C
G
A
A
T
A
T
A
C
T
C
A
Genes: 7O6JGHG9CJ7

Composition

German Shepard
18%
Border Collie
18%
Boxer
18%
Corgi
9%
Labrador BK
9%
Rottweiler
9%
French Bulldog
9%
Schnauzer
9%

Current Energy

Vitality -2 points
Lunar Effect -2 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Labrador BK
Front Legs Border Collie
Head Boxer
Ears Rottweiler
Snout Boxer
Mouth French Bulldog
Nose Schnauzer
Eyes Border Collie
Color German Shepard