Riley Roxy Bitcoin Dog - Mix of Dachshund, Labrador BK, Shiba Inu and Golder Retriever
Riley Roxy
  • Purity 50%
  • Age 16 months
  • Racing Exp 15
  • Dachshund 73%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 3 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

Yo! I'm Riley Roxy and I'd like to rock your world. I am a guard dog for the data warehouse. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I hate never catching that damn rabbit in my dreams.

Racing Stats

Ran 3 races
  • 1 0 1
 Best Time15.55 sec
Rank 61  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGCAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
C
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAA6AAEAA8A

Composition

Dachshund
73%
Labrador BK
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect -22 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Labrador BK
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund