Riley Roxy Bitcoin Dog - Mix of Dachshund, Labrador BK, Shiba Inu and Golder Retriever

Achievements

Racer
Riley Roxy
Yo! I'm Riley Roxy and I'd like to rock your world. I am a guard dog for the data warehouse. I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... I hate never catching that damn rabbit in my dreams.
  • Purity 50%
  • Age 23 months
  • Racing Exp 15
  • Dachshund 73%
  • 3 races
  • Gen 5
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 1 0 1
 Best Time15.55 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGCAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
C
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAA6AAEAA8A

Composition

Dachshund
73%
Labrador BK
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Labrador BK
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund