Corvette Cupcake Digital Cryptocurrency Dog - Mix of Dachshund, Schnauzer, Maltese, Pug, German Shepard and Corgi
Corvette Cupcake
  • Purity 14%
  • Age 71 months
  • Racing Exp 185
  • Dachshund 27%
  • Gold medal 9 Silver medal 5 Bronze medal 7
  • 57 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
Podium Champion
Master Champion

Bio

I like never worrying about my dog poo. I've got people for that. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Spiked dog collars really turn me on. I hate it when my humans fart and they blame me!

Racing Stats

Ran 57 races
  • 9 5 7
 Best Time14.28 sec
Rank 65  RacingĀ *** Pts
36.8% wins (21) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGAAGGATCAATAACCACCAGCGGAATAATA
G
G
A
G
A
A
G
G
A
T
C
A
A
T
A
A
C
C
A
C
C
A
G
C
G
G
A
A
T
A
A
T
A
Genes: A2A7CKKOACC

Composition

Dachshund
27%
Schnauzer
27%
Maltese
18%
Pug
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -37 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Dachshund
Front Legs German Shepard
Head Schnauzer
Ears Maltese
Snout Maltese
Mouth Corgi
Nose Dachshund
Eyes Schnauzer
Color Schnauzer