Corvette Cupcake Digital Cryptocurrency Dog - Mix of Dachshund, Schnauzer, Maltese, Pug, German Shepard and Corgi

Achievements

Racer
Podium Champion
Master Champion
Corvette Cupcake
I like never worrying about my dog poo. I've got people for that. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Spiked dog collars really turn me on. I hate it when my humans fart and they blame me!
  • Purity 14%
  • Age 41 months
  • Racing Exp 172
  • Dachshund 27%
  • 54 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 9 5 5
54 races    Best Time14.28 sec
Rank 20  Racing *** Coins
35.2 % wins (19) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: GGAGAAGGATCAATAACCACCAGCGGAATAATA
G
G
A
G
A
A
G
G
A
T
C
A
A
T
A
A
C
C
A
C
C
A
G
C
G
G
A
A
T
A
A
T
A
Genes: A2A7CKKOACC

Composition

Dachshund
27%
Schnauzer
27%
Maltese
18%
Pug
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -37 points
Lunar Effect +6 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Dachshund
Front Legs German Shepard
Head Schnauzer
Ears Maltese
Snout Maltese
Mouth Corgi
Nose Dachshund
Eyes Schnauzer
Color Schnauzer