Corvette Cupcake Digital Cryptocurrency Dog - Mix of Dachshund, Schnauzer, Maltese, Pug, German Shepard and Corgi

Achievements

Racer
Podium Champion
Master Champion
Corvette Cupcake
I like never worrying about my dog poo. I've got people for that. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! Spiked dog collars really turn me on. I hate it when my humans fart and they blame me!
  • Purity 14%
  • Age 38 months
  • Racing Exp 210
  • Dachshund 27%
  • 65 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

65 races   |
  • 10 5 9
 Best Time14.28 sec
No rank  Racing *** Pts
36.9 % wins (24) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGAAGGATCAATAACCACCAGCGGAATAATA
G
G
A
G
A
A
G
G
A
T
C
A
A
T
A
A
C
C
A
C
C
A
G
C
G
G
A
A
T
A
A
T
A
Genes: A2A7CKKOACC

Composition

Dachshund
27%
Schnauzer
27%
Maltese
18%
Pug
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -37 points
Lunar Effect -16 points

Traits Breakdown

Body Dachshund
Tail Pug
Legs Dachshund
Front Legs German Shepard
Head Schnauzer
Ears Maltese
Snout Maltese
Mouth Corgi
Nose Dachshund
Eyes Schnauzer
Color Schnauzer

Parents

Children

Photos

Litecoin doggy racing crypto dog racing podium Bitcoin canine race podium Bitcoin dog race podium Litecoin dog race podium Litecoin dog race podium cryptocurrency doggy racing results crypto dog racing results