Verona Volkswagen Digital Cryptocurrency Dog - Mix of Golder Retriever, Pug, Husky, Grey Wolf, Border Collie, Boxer and Yorkshire Terrier
Verona Volkswagen
  • Purity 6%
  • Age 13 months
  • Racing Exp 10
  • Golder Retriever 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer
TOP 10 Fastest

Bio

Greetings. My name is Verona Volkswagen. I live inside of a Virtual machine two steps to the right from the firewall. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.

Racing Stats

Ran 3 races
  • 1 0 0
 Best Time14.87 sec
Rank 10  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGAGAATACACACCCAACAGAGAACCCACATTA
A
G
A
G
A
A
T
A
C
A
C
A
C
C
C
A
A
C
A
G
A
G
A
A
C
C
C
A
C
A
T
T
A
Genes: 82J4LG82L4F

Composition

Golder Retriever
18%
Pug
18%
Husky
18%
Grey Wolf
18%
Border Collie
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -7 points
Lunar Effect -2 points

Traits Breakdown

Body Golder Retriever
Tail Pug
Legs Border Collie
Front Legs Husky
Head Grey Wolf
Ears Boxer
Snout Golder Retriever
Mouth Pug
Nose Grey Wolf
Eyes Husky
Color Yorkshire Terrier