Solid Snake Schotzie Digital Cryptocurrency Dog - Mix of German Shepard, Labrador, Border Collie, Pitbull terrier, Dachshund, Corgi, St. Bernard and Husky
Solid Snake Schotzie
  • Purity 9%
  • Age 18 months
  • Racing Exp 0
  • German Shepard 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 2
Depressed & Snaillike

Achievements

None

Bio

Who's a good dog? Hopefully you! Solid Snake Schotzie here. I'll be honest...Napping is my favorite so we gotta go slow. My turn-offs are rolled up newspapers and loud noises. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCATCATCATACCCATCCGGAAGCTGAACACCA
T
C
A
T
C
A
T
C
A
T
A
C
C
C
A
T
C
C
G
G
A
A
G
C
T
G
A
A
C
A
C
C
A
Genes: 777J5NAOB45

Composition

German Shepard
27%
Labrador
18%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%
Husky
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs Border Collie
Head Labrador
Ears Pitbull terrier
Snout Dachshund
Mouth Corgi
Nose St. Bernard
Eyes Husky
Color Labrador

Parents

No Children

Gift