Solid Snake Schotzie Digital Cryptocurrency Dog - Mix of German Shepard, Labrador, Border Collie, Pitbull terrier, Dachshund, Corgi, St. Bernard and Husky

Achievements

None
Solid Snake Schotzie
Who's a good dog? Hopefully you! Solid Snake Schotzie here. I'll be honest...Napping is my favorite so we gotta go slow. My turn-offs are rolled up newspapers and loud noises. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 9%
  • Age 21 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATACCCATCCGGAAGCTGAACACCA
T
C
A
T
C
A
T
C
A
T
A
C
C
C
A
T
C
C
G
G
A
A
G
C
T
G
A
A
C
A
C
C
A
Genes: 777J5NAOB45

Composition

German Shepard
27%
Labrador
18%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%
Husky
9%

Current Energy

Vitality -8 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs Border Collie
Head Labrador
Ears Pitbull terrier
Snout Dachshund
Mouth Corgi
Nose St. Bernard
Eyes Husky
Color Labrador

Parents

No Children