Archibald Ally Cryptocurrency Dog - Mix of Schnauzer, Boxer, Golder Retriever, Shiba Inu, Border Collie, Pitbull terrier, Dachshund and German Shepard

Achievements

Racer
Archibald Ally
I answer to 'Archibald Ally'. Creativity is my middle name... I turn everything in to a chew toy. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My humans should try spending 8 hours a day in a crate! I absolutely love long walks when I can stop and smell the bushes.
  • Purity 6%
  • Age 38 months
  • Racing Exp 6
  • Schnauzer 27%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 1
 Best Time16.28 sec
No rank  Racing *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAAACATAGTATACAACATATCCGGATCAATA
A
G
A
A
A
C
A
T
A
G
T
A
T
A
C
A
A
C
A
T
A
T
C
C
G
G
A
T
C
A
A
T
A
Genes: 8GCEJGCNA7C

Composition

Schnauzer
27%
Boxer
18%
Golder Retriever
9%
Shiba Inu
9%
Border Collie
9%
Pitbull terrier
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -37 points
Lunar Effect 0 points

Traits Breakdown

Body Golder Retriever
Tail Boxer
Legs Schnauzer
Front Legs Shiba Inu
Head Border Collie
Ears Boxer
Snout Schnauzer
Mouth Pitbull terrier
Nose Dachshund
Eyes German Shepard
Color Schnauzer