Tank Tank Crypto Game Dog - Mix of St. Bernard, Shiba Inu, German Shepard and Poodle
Tank Tank
  • Purity 41%
  • Age 13 months
  • Racing Exp 1
  • St. Bernard 64%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

Well hello, beautiful. My name's Tank Tank. I'm into group dog piles, the more the better. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy!

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time18.03 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TGATCAGTATGATGAGACGTATGATGATGATGA
T
G
A
T
C
A
G
T
A
T
G
A
T
G
A
G
A
C
G
T
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: B7EBBIEBBBB

Composition

St. Bernard
64%
Shiba Inu
18%
German Shepard
9%
Poodle
9%

Current Energy

Vitality -50 points
Lunar Effect +12 points

Traits Breakdown

Body St. Bernard
Tail German Shepard
Legs Shiba Inu
Front Legs St. Bernard
Head St. Bernard
Ears Poodle
Snout Shiba Inu
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard

Parents

No Children

Photos

Gift