Tank Tank Crypto Game Dog - Mix of St. Bernard, Shiba Inu, German Shepard and Poodle

Achievements

Racer
Podium Champion
Tank Tank
Well hello, beautiful. My name's Tank Tank. I'm into group dog piles, the more the better. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy!
  • Purity 41%
  • Age 18 months
  • Racing Exp 43
  • St. Bernard 64%
  • 20 races
  • Gen 11
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

20 races   |
  • 1 1 2
 Best Time15.78 sec
No rank  Racing *** Pts
20.0 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGATCAGTATGATGAGACGTATGATGATGATGA
T
G
A
T
C
A
G
T
A
T
G
A
T
G
A
G
A
C
G
T
A
T
G
A
T
G
A
T
G
A
T
G
A
Genes: B7EBBIEBBBB

Composition

St. Bernard
64%
Shiba Inu
18%
German Shepard
9%
Poodle
9%

Current Energy

Vitality -50 points
Lunar Effect +4 points

Traits Breakdown

Body St. Bernard
Tail German Shepard
Legs Shiba Inu
Front Legs St. Bernard
Head St. Bernard
Ears Poodle
Snout Shiba Inu
Mouth St. Bernard
Nose St. Bernard
Eyes St. Bernard
Color St. Bernard