Godiva Georgie Cryptocurrency Dog - Mix of Husky, Beagle, Pitbull terrier, Boxer, Schnauzer, French Bulldog, Labrador BK and Corgi
Godiva Georgie
  • Purity 4%
  • Age 21 months
  • Racing Exp 16
  • Husky 18%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 4 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

I'm Godiva Georgie and I'd like to show you a trick or two. The internet's my home. I'll outrun you for the ball if I can...that's just how I roll. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!

Racing Stats

Ran 4 races
  • 1 0 1
 Best Time16.07 sec
No rank  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AACATACGAGCAACACTAACACTATCCAGCTCC
A
A
C
A
T
A
C
G
A
G
C
A
A
C
A
C
T
A
A
C
A
C
T
A
T
C
C
A
G
C
T
C
C
Genes: GC964D4DNON

Composition

Husky
18%
Beagle
18%
Pitbull terrier
18%
Boxer
9%
Schnauzer
9%
French Bulldog
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -25 points
Lunar Effect -6 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs French Bulldog
Front Legs Labrador BK
Head Husky
Ears Beagle
Snout Husky
Mouth Beagle
Nose Pitbull terrier
Eyes Corgi
Color Pitbull terrier

Parents

No Children

Photos

Bitcoin dog racing online doggy race photo
Gift