Godiva Georgie Cryptocurrency Dog - Mix of Husky, Beagle, Pitbull terrier, Boxer, Schnauzer, French Bulldog, Labrador BK and Corgi

Achievements

Racer
Godiva Georgie
I'm Godiva Georgie and I'd like to show you a trick or two. The internet's my home. I'll outrun you for the ball if I can...that's just how I roll. I wish I could spend every weekend going camping with my human. All the animals out there smell so funny!
  • Purity 4%
  • Age 23 months
  • Racing Exp 43
  • Husky 18%
  • 14 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 2 0 3
 Best Time15.40 sec
No rank  Racing *** Pts
35.7 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACATACGAGCAACACTAACACTATCCAGCTCC
A
A
C
A
T
A
C
G
A
G
C
A
A
C
A
C
T
A
A
C
A
C
T
A
T
C
C
A
G
C
T
C
C
Genes: GC964D4DNON

Composition

Husky
18%
Beagle
18%
Pitbull terrier
18%
Boxer
9%
Schnauzer
9%
French Bulldog
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -25 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs French Bulldog
Front Legs Labrador BK
Head Husky
Ears Beagle
Snout Husky
Mouth Beagle
Nose Pitbull terrier
Eyes Corgi
Color Pitbull terrier

Parents

No Children

Photos

cryptocurrency doggy racing podium virtual doggy race podium cryptocurrency dog race podium virtual pet race photo Bitcoin pet race photo