Munchkin Mimi Bitcoin Game Dog - Mix of Husky, Pitbull terrier, French Bulldog, Grey Wolf, Schnauzer, St. Bernard, German Shepard, Beagle and Poodle

Achievements

Racer
Munchkin Mimi
Hello, I'm Munchkin Mimi. How's it goin'? I run with a pack in the data warehouse. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm ready to settle down and have puppies...what about you?
  • Purity 3%
  • Age 26 months
  • Racing Exp 17
  • Husky 18%
  • 4 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
4 races    Best Time15.88 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGACCCATATGAACATCAACACTATCCGACTCC
C
G
A
C
C
C
A
T
A
T
G
A
A
C
A
T
C
A
A
C
A
C
T
A
T
C
C
G
A
C
T
C
C
Genes: 9LCB474DNIN

Composition

Husky
18%
Pitbull terrier
18%
French Bulldog
9%
Grey Wolf
9%
Schnauzer
9%
St. Bernard
9%
German Shepard
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality -51 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Grey Wolf
Legs Schnauzer
Front Legs St. Bernard
Head Husky
Ears German Shepard
Snout Husky
Mouth Beagle
Nose Pitbull terrier
Eyes Poodle
Color Pitbull terrier