Munchkin Mimi

Hello, I'm Munchkin Mimi. How's it goin'? I run with a pack in the data warehouse. I need laid otherwise I'm going to start agreeing with Grumpy Cat. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I'm ready to settle down and have puppies...what about you?

Purity 3%
Age 26 months
Racing Exp 17

Husky 18%
4 races
Gen 0

Sad & Tardy

Energy: ▂▃▅▆▇

Racing Stats

1 1 0


4 races	Best Time	15.88 sec
No rank	Racing	*** Coins
50.0 % wins (2)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: CGACCCATATGAACATCAACACTATCCGACTCC

Genes: 9LCB474DNIN

Composition

Husky	18%
Pitbull terrier	18%
French Bulldog	9%
Grey Wolf	9%
Schnauzer	9%
St. Bernard	9%
German Shepard	9%
Beagle	9%
Poodle	9%

Current Energy

Vitality	-51 points
Lunar Effect	-4 points

Traits Breakdown

Body	French Bulldog
Tail	Grey Wolf
Legs	Schnauzer
Front Legs	St. Bernard
Head	Husky
Ears	German Shepard
Snout	Husky
Mouth	Beagle
Nose	Pitbull terrier
Eyes	Poodle
Color	Pitbull terrier