Slap Hitter Savannah Bitcoin Dog - Mix of Husky, Poodle, French Bulldog, German Shepard, Border Collie, St. Bernard, Dachshund, Labrador BK and Pitbull terrier

Achievements

Racer
Podium Champion
Slap Hitter Savannah
What's up, dog? I'm Slap Hitter Savannah! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I hate bubble baths; mud puddles are more my style. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. Just looking to sow some wild oats here...
  • Purity 5%
  • Age 23 months
  • Racing Exp 49
  • Husky 18%
  • 16 races
  • Gen 1
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 1 1 4
 Best Time15.60 sec
No rank  Racing *** Pts
37.5 % wins (6) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGATCATACTGAACAGGAACAGCATCCGACGAC
C
G
A
T
C
A
T
A
C
T
G
A
A
C
A
G
G
A
A
C
A
G
C
A
T
C
C
G
A
C
G
A
C
Genes: 97JB4A46NII

Composition

Husky
18%
Poodle
18%
French Bulldog
9%
German Shepard
9%
Border Collie
9%
St. Bernard
9%
Dachshund
9%
Labrador BK
9%
Pitbull terrier
9%

Current Energy

Vitality -20 points
Lunar Effect -2 points

Traits Breakdown

Body French Bulldog
Tail German Shepard
Legs Border Collie
Front Legs St. Bernard
Head Husky
Ears Dachshund
Snout Husky
Mouth Labrador BK
Nose Pitbull terrier
Eyes Poodle
Color Poodle