Slap Hitter Savannah Bitcoin Dog - Mix of Husky, Poodle, French Bulldog, German Shepard, Border Collie, St. Bernard, Dachshund, Labrador BK and Pitbull terrier
Slap Hitter Savannah
  • Purity 5%
  • Age 20 months
  • Racing Exp 11
  • Husky 18%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 5 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

What's up, dog? I'm Slap Hitter Savannah! If I had to pick a favorite food it would be a hot-dog, because you are what you eat! I hate bubble baths; mud puddles are more my style. Of course, I'm micro-chipped. I'm up on all the latest tech gadgets. Just looking to sow some wild oats here...

Racing Stats

Ran 5 races
  • 0 1 0
 Best Time15.60 sec
Rank 67  RacingĀ *** Pts
20.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CGATCATACTGAACAGGAACAGCATCCGACGAC
C
G
A
T
C
A
T
A
C
T
G
A
A
C
A
G
G
A
A
C
A
G
C
A
T
C
C
G
A
C
G
A
C
Genes: 97JB4A46NII

Composition

Husky
18%
Poodle
18%
French Bulldog
9%
German Shepard
9%
Border Collie
9%
St. Bernard
9%
Dachshund
9%
Labrador BK
9%
Pitbull terrier
9%

Current Energy

Vitality -20 points
Lunar Effect -2 points

Traits Breakdown

Body French Bulldog
Tail German Shepard
Legs Border Collie
Front Legs St. Bernard
Head Husky
Ears Dachshund
Snout Husky
Mouth Labrador BK
Nose Pitbull terrier
Eyes Poodle
Color Poodle

Parents

No Children

Photos

Bitcoin pet race
Gift