Moose Mario Cryptocurrency Dog - Mix of Beagle, Boxer, Schnauzer, Dachshund, Labrador BK, Rottweiler, Labrador, Maltese, Corgi and Yorkshire Terrier

Achievements

Podium Champion
Pro Racer
Moose Mario
I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. Chasing anything that will run is so much fun, I could do that all day. I like giving wet kisses. I hate hiding under the bed during a thunder storm but that's just smart, right?
  • Purity 3%
  • Age 26 months
  • Racing Exp 42
  • Beagle 18%
  • 13 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 2 2
13 races    Best Time16.02 sec
Rank 63  Racing *** Coins
38.5 % wins (5) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AACATAGGAGCACTACTACACCCAACCAGCTTA
A
A
C
A
T
A
G
G
A
G
C
A
C
T
A
C
T
A
C
A
C
C
C
A
A
C
C
A
G
C
T
T
A
Genes: GCA6DDH5KOF

Composition

Beagle
18%
Boxer
9%
Schnauzer
9%
Dachshund
9%
Labrador BK
9%
Rottweiler
9%
Labrador
9%
Maltese
9%
Corgi
9%
Yorkshire Terrier
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Dachshund
Front Legs Labrador BK
Head Beagle
Ears Beagle
Snout Rottweiler
Mouth Labrador
Nose Maltese
Eyes Corgi
Color Yorkshire Terrier