Tinker Turner Digital Cryptocurrency Dog - Mix of Schnauzer, Boxer, Dachshund, Pitbull terrier, St. Bernard, Labrador, Maltese and Yorkshire Terrier

Achievements

Racer
Tinker Turner
Hi, Tinker Turner is my name. I slept with a cat and I liked it. I believe running along the beach to catch a stick can be nearly orgasmic. I hate it when other dogs pee in my yard! IT'S MY YARD!! I want a mate that knows how to give a proper belly rub!
  • Purity 6%
  • Age 40 months
  • Racing Exp 21
  • Schnauzer 27%
  • 9 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 1
9 races    Best Time16.25 sec
Rank 89  Racing *** Coins
22.2 % wins (2) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AACATAGGAATATCCAACTGACCAACCTTAATA
A
A
C
A
T
A
G
G
A
A
T
A
T
C
C
A
A
C
T
G
A
C
C
A
A
C
C
T
T
A
A
T
A
Genes: GCACNGB5KFC

Composition

Schnauzer
27%
Boxer
18%
Dachshund
9%
Pitbull terrier
9%
St. Bernard
9%
Labrador
9%
Maltese
9%
Yorkshire Terrier
9%

Current Energy

Vitality -52 points
Lunar Effect +12 points

Traits Breakdown

Body Boxer
Tail Schnauzer
Legs Dachshund
Front Legs Schnauzer
Head Pitbull terrier
Ears Boxer
Snout St. Bernard
Mouth Labrador
Nose Maltese
Eyes Yorkshire Terrier
Color Schnauzer