Hitomi Hitomi Bitcoin Dog - Mix of Shiba Inu, Labrador, St. Bernard, Husky, German Shepard, Dachshund and Beagle

Achievements

None
Hitomi Hitomi
Aggressive dogs that don't let 'me be me' frustrate me. If I can't reach it to clean it myself, it doesn't need cleaning! I enjoy staying active, and running circles around puppies and young children. As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 12%
  • Age 26 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTATGACCAACATCAGTACCAGTAGGACTAGTA
G
T
A
T
G
A
C
C
A
A
C
A
T
C
A
G
T
A
C
C
A
G
T
A
G
G
A
C
T
A
G
T
A
Genes: EB547E5EADE

Composition

Shiba Inu
36%
Labrador
18%
St. Bernard
9%
Husky
9%
German Shepard
9%
Dachshund
9%
Beagle
9%

Current Energy

Vitality -11 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail St. Bernard
Legs Labrador
Front Legs Husky
Head German Shepard
Ears Shiba Inu
Snout Labrador
Mouth Shiba Inu
Nose Dachshund
Eyes Beagle
Color Shiba Inu