Patty Pepsi Crypto Dog - Mix of Golder Retriever, Labrador BK, St. Bernard, Husky, Boxer, Pug, German Shepard, Grey Wolf, Corgi and Rottweiler

Achievements

None
Patty Pepsi
Have you ever dated a digital creation before? You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. Fences are just challenges...I don't let them stop me! I want to find that special friend who enjoys sharing each other's doggie bags.
  • Purity 3%
  • Age 41 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATGAAGAAGAACAAACGAATCACCCAGCCAC
G
C
A
T
G
A
A
G
A
A
G
A
A
C
A
A
A
C
G
A
A
T
C
A
C
C
C
A
G
C
C
A
C
Genes: 6B884G27LOH

Composition

Golder Retriever
18%
Labrador BK
9%
St. Bernard
9%
Husky
9%
Boxer
9%
Pug
9%
German Shepard
9%
Grey Wolf
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -12 points
Lunar Effect -6 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs Golder Retriever
Front Legs Golder Retriever
Head Husky
Ears Boxer
Snout Pug
Mouth German Shepard
Nose Grey Wolf
Eyes Corgi
Color Rottweiler

Parents

No Children