Rynn Ridley Litecoin Dog - Mix of Grey Wolf, Dachshund, Pug, St. Bernard, Boxer, German Shepard, Corgi and Shiba Inu

Achievements

Racer
Rynn Ridley
If you'd like to get together, I'm Rynn Ridley. Have you ever dated a digital creation before? My human says I'm loyal, intelligent, devoted and affectionate. Rolling around on the carpet after a bath is my favorite way to dry. I'm ready to settle down and have puppies...what about you?
  • Purity 6%
  • Age 42 months
  • Racing Exp 33
  • Grey Wolf 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 2
9 races    Best Time15.17 sec
No rank  Racing *** Coins
44.4 % wins (4) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTGAGGAGGAGAAAACGAATCACCCAGCGTA
C
C
C
T
G
A
G
G
A
G
G
A
G
A
A
A
A
C
G
A
A
T
C
A
C
C
C
A
G
C
G
T
A
Genes: LBAA2G27LOE

Composition

Grey Wolf
18%
Dachshund
18%
Pug
18%
St. Bernard
9%
Boxer
9%
German Shepard
9%
Corgi
9%
Shiba Inu
9%

Current Energy

Vitality -35 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail St. Bernard
Legs Dachshund
Front Legs Dachshund
Head Pug
Ears Boxer
Snout Pug
Mouth German Shepard
Nose Grey Wolf
Eyes Corgi
Color Shiba Inu