Yoko Yang Cryptocurrency Game Dog - Mix of German Shepard, Rottweiler, Pug, Golder Retriever, Husky, Maltese, Labrador and Labrador BK

Achievements

Racer
Yoko Yang
Yoko Yang here. Wanna play? I may need de-worming. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. Slipping my collar, running off and making my humans worried? Every chance I get. New experiences? New treats? New places! Yes, please!
  • Purity 8%
  • Age 41 months
  • Racing Exp 1
  • German Shepard 27%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.52 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAAGACACACATCATCAACCCCAGCACAC
T
C
A
G
A
A
A
G
A
C
A
C
A
C
A
T
C
A
T
C
A
A
C
C
C
C
A
G
C
A
C
A
C
Genes: 728H477K56H

Composition

German Shepard
27%
Rottweiler
18%
Pug
9%
Golder Retriever
9%
Husky
9%
Maltese
9%
Labrador
9%
Labrador BK
9%

Current Energy

Vitality -21 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Golder Retriever
Front Legs Rottweiler
Head Husky
Ears German Shepard
Snout German Shepard
Mouth Maltese
Nose Labrador
Eyes Labrador BK
Color Rottweiler

Parents

No Children

Photos