Spark Sparkplug Cryptocurrency Dog - Mix of German Shepard and Shiba Inu

Achievements

Racer
Spark Sparkplug
What's up, pup? Name's Spark Sparkplug. I'm into group dog piles, the more the better. I don't like going to the groomer. Leave my beautiful fur alone! I like it when you're frisky. I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 82%
  • Age 38 months
  • Racing Exp 3
  • German Shepard 91%
  • 3 races
  • Gen 9
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 0
 Best Time14.17 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCATCATCATCATCATCATCATCATCATCAGTA
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
T
C
A
G
T
A
Genes: 7777777777E

Composition

German Shepard
91%
Shiba Inu
9%

Current Energy

Vitality -12 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears German Shepard
Snout German Shepard
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Shiba Inu