Baron Buffy Litecoin Dog - Mix of Schnauzer, German Shepard, Golder Retriever and Dachshund

Achievements

Racer
Baron Buffy
My favorite position is doggie style ;) Size doesn't matter, I like 'em all. I'll outrun you for the ball if I can...that's just how I roll. Aggressive dogs that don't let 'me be me' frustrate me.
  • Purity 29%
  • Age 41 months
  • Racing Exp 1
  • Schnauzer 45%
  • 1 races
  • Gen 10
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time17.37 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGATCAATAATATCATCAATAATAGGATCAATA
A
G
A
T
C
A
A
T
A
A
T
A
T
C
A
T
C
A
A
T
A
A
T
A
G
G
A
T
C
A
A
T
A
Genes: 87CC77CCA7C

Composition

Schnauzer
45%
German Shepard
36%
Golder Retriever
9%
Dachshund
9%

Current Energy

Vitality -51 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail German Shepard
Legs Schnauzer
Front Legs Schnauzer
Head German Shepard
Ears German Shepard
Snout Schnauzer
Mouth Schnauzer
Nose Dachshund
Eyes German Shepard
Color Schnauzer