Honeybee Huey Crypto Game Dog - Mix of Yorkshire Terrier, Labrador BK, Pitbull terrier, Border Collie, Corgi, Labrador, Rottweiler, Golder Retriever and German Shepard

Achievements

None
Honeybee Huey
I like giving wet kisses. I hate having to share my food dish... I've always had a crush on Lassie. Little Bow Wow is my favorite musician. I just assume he's a dog...
  • Purity 3%
  • Age 41 months
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTACTTAGCAAGCCCACACTTAAGAGCATCA
T
C
C
T
A
C
T
T
A
G
C
A
A
G
C
C
C
A
C
A
C
T
T
A
A
G
A
G
C
A
T
C
A
Genes: NJF6O5HF867

Composition

Yorkshire Terrier
18%
Labrador BK
18%
Pitbull terrier
9%
Border Collie
9%
Corgi
9%
Labrador
9%
Rottweiler
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality -35 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Border Collie
Legs Yorkshire Terrier
Front Legs Labrador BK
Head Corgi
Ears Labrador
Snout Rottweiler
Mouth Yorkshire Terrier
Nose Golder Retriever
Eyes Labrador BK
Color German Shepard