Hunter Hugh Bitcoin Dog - Mix of Pug and German Shepard

Achievements

Racer
Hunter Hugh
Howdy there. I'm Hunter Hugh. Nyan Cat is my best friend here in the cyberspace. People food disagrees with me. Whew! You can tell. Chasing anything that will run is so much fun, I could do that all day. I don't like to be ignored. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 58%
  • Age 20 months
  • Racing Exp 10
  • Pug 73%
  • 4 races
  • Gen 16
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
4 races    Best Time14.97 sec
No rank  Racing *** Coins
25.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAATCATCAGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
T
C
A
T
C
A
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 22277222722

Composition

Pug
73%
German Shepard
27%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs German Shepard
Head German Shepard
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug

Parents

Children

Photos

Bitcoin dog race podium online pet racing results cryptocurrency canine race Bitcoin pet racing crypto pet racing results Bitcoin doggy racing virtual pet race podium virtual dog racing results