Hunter Hugh Bitcoin Dog - Mix of Pug and German Shepard
Hunter Hugh
  • Purity 58%
  • Age 13 months
  • Racing Exp 10
  • Pug 73%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 4 races
  • Gen 16
Depressed & Snaillike

Achievements

Racer

Bio

Howdy there. I'm Hunter Hugh. Nyan Cat is my best friend here in the cyberspace. People food disagrees with me. Whew! You can tell. Chasing anything that will run is so much fun, I could do that all day. I don't like to be ignored. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 4 races
  • 0 1 0
 Best Time14.97 sec
No rank  RacingĀ *** Pts
25.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATCATCAGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
T
C
A
T
C
A
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 22277222722

Composition

Pug
73%
German Shepard
27%

Current Energy

Vitality -39 points
Lunar Effect -8 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs German Shepard
Head German Shepard
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug

Parents

No Children

Photos

cryptocurrency dog racing
Gift