Hunter Hugh Bitcoin Dog - Mix of Pug and German Shepard
Hunter Hugh
  • Purity 58%
  • Age 17 months
  • Racing Exp 56
  • Pug 73%
  • Gold medal 1 Silver medal 5 Bronze medal 1
  • 14 races
  • Gen 16
Sad & Snaillike

Achievements

Pro Racer
Podium Champion

Bio

Howdy there. I'm Hunter Hugh. Nyan Cat is my best friend here in the cyberspace. People food disagrees with me. Whew! You can tell. Chasing anything that will run is so much fun, I could do that all day. I don't like to be ignored. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 14 races
  • 1 5 1
 Best Time14.97 sec
Rank 42  RacingĀ *** Pts
50.0 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATCATCAGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
T
C
A
T
C
A
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 22277222722

Composition

Pug
73%
German Shepard
27%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs German Shepard
Head German Shepard
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug

Parents

No Children

Photos

online canine race cryptocurrency dog racing podium Bitcoin pet race photo cryptocurrency doggy race online dog race photo cryptocurrency canine racing crypto canine racing
Gift