Hunter Hugh Bitcoin Dog - Mix of Pug and German Shepard
Hunter Hugh
  • Purity 58%
  • Age 51 months
  • Racing Exp 57
  • Pug 73%
  • Gold medal 1 Silver medal 5 Bronze medal 1
  • 15 races
  • Gen 16
Depressed & Snaillike

Achievements

Pro Racer
Podium Champion

Bio

Howdy there. I'm Hunter Hugh. Nyan Cat is my best friend here in the cyberspace. People food disagrees with me. Whew! You can tell. Chasing anything that will run is so much fun, I could do that all day. I don't like to be ignored. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.

Racing Stats

Ran 15 races
  • 1 5 1
 Best Time14.97 sec
No rank  RacingĀ *** Pts
46.7% wins (7) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAATCATCAGAAGAAGAATCAGAAGAA
G
A
A
G
A
A
G
A
A
T
C
A
T
C
A
G
A
A
G
A
A
G
A
A
T
C
A
G
A
A
G
A
A
Genes: 22277222722

Composition

Pug
73%
German Shepard
27%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs German Shepard
Head German Shepard
Ears Pug
Snout Pug
Mouth Pug
Nose German Shepard
Eyes Pug
Color Pug

Parents

No Children

Photos

cryptocurrency dog race Litecoin doggy race photo crypto pet racing Bitcoin dog racing photo virtual pet race podium virtual dog racing Bitcoin dog race podium
Gift