Creeper Cyrano Litecoin Dog - Mix of Pug, Labrador BK, Border Collie, Labrador and Husky
Creeper Cyrano
  • Purity 29%
  • Age 17 months
  • Racing Exp 98
  • Pug 55%
  • Gold medal 3 Silver medal 5 Bronze medal 3
  • 32 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer
Podium Champion
Master Champion

Bio

I live in cyberspace where you can turn me on. Squeaky toys are the best, don't you agree? I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.

Racing Stats

Ran 32 races
  • 3 5 3
 Best Time15.18 sec
No rank  RacingĀ *** Pts
34.4 % wins (11) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCAGAAGAATACGCACCAGAAGAAGAAACAGAA
G
C
A
G
A
A
G
A
A
T
A
C
G
C
A
C
C
A
G
A
A
G
A
A
G
A
A
A
C
A
G
A
A
Genes: 622J6522242

Composition

Pug
55%
Labrador BK
18%
Border Collie
9%
Labrador
9%
Husky
9%

Current Energy

Vitality -31 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Pug
Front Legs Border Collie
Head Labrador BK
Ears Labrador
Snout Pug
Mouth Pug
Nose Pug
Eyes Husky
Color Pug