Pepe Porche Bitcoin Dog - Mix of Pug, Shiba Inu and Labrador BK

Achievements

Racer
Pepe Porche
Howdy there. I'm Pepe Porche. I think hamsters and cats are both over-rated. I love unconditionally. Long or short hair works for me, just no baldies please. Slipping my collar, running off and making my humans worried? Every chance I get. Fun-loving and playful only need apply.
  • Purity 67%
  • Age 20 months
  • Racing Exp 9
  • Pug 82%
  • 3 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time14.72 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAGAAGAAGTAGCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
G
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222E6222222

Composition

Pug
82%
Shiba Inu
9%
Labrador BK
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Labrador BK
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug

Parents

No Children

Photos

Litecoin dog racing Litecoin doggy racing online doggy racing crypto pet racing