Pepe Porche Bitcoin Dog - Mix of Pug, Shiba Inu and Labrador BK
Pepe Porche
  • Purity 67%
  • Age 17 months
  • Racing Exp 27
  • Pug 82%
  • Gold medal 2 Silver medal 1 Bronze medal 0
  • 7 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

Howdy there. I'm Pepe Porche. I think hamsters and cats are both over-rated. I love unconditionally. Long or short hair works for me, just no baldies please. Slipping my collar, running off and making my humans worried? Every chance I get. Fun-loving and playful only need apply.

Racing Stats

Ran 7 races
  • 2 1 0
 Best Time14.72 sec
No rank  RacingĀ *** Pts
42.9 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GAAGAAGAAGTAGCAGAAGAAGAAGAAGAAGAA
G
A
A
G
A
A
G
A
A
G
T
A
G
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
Genes: 222E6222222

Composition

Pug
82%
Shiba Inu
9%
Labrador BK
9%

Current Energy

Vitality -64 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail Pug
Legs Pug
Front Legs Shiba Inu
Head Labrador BK
Ears Pug
Snout Pug
Mouth Pug
Nose Pug
Eyes Pug
Color Pug