Ruffles Rascal Bitcoin Dog - Mix of Border Collie and Rottweiler

Achievements

Podium Champion
Pro Racer
Master Champion
Ruffles Rascal
Too much steak gives me the runs! I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! My turn-offs are rolled up newspapers and loud noises. I like tennis balls. And baseballs. And squeaky balls. Really anything round and mouth-sized.
  • Purity 82%
  • Age 37 months
  • Racing Exp 81
  • Border Collie 91%
  • 19 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

19 races   |
  • 3 6 1
 Best Time14.00 sec
Rank 90  Racing *** Pts
52.6 % wins (10) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: TACTACTACTACTACTACTACTACTACTACCAC
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
C
A
C
Genes: JJJJJJJJJJH

Composition

Border Collie
91%
Rottweiler
9%

Current Energy

Vitality +7 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Border Collie
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color Rottweiler