Hope Hawkeye Crypto Game Dog - Mix of Border Collie, Rottweiler and St. Bernard

Achievements

Racer
Speed Champion
Hope Hawkeye
Hey, Baby. I'm Hope Hawkeye. I keep my well-built figure with zeros and ones. I adore sleeping upside down with my tongue hanging out! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!
  • Purity 65%
  • Age 39 months
  • Racing Exp 69
  • Border Collie 82%
  • 22 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 8
22 races    Best Time13.92 sec
Rank 75  Racing *** Coins
40.9 % wins (9) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACTACTACTACTACTACCACTACTACTACTGA
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
T
A
C
C
A
C
T
A
C
T
A
C
T
A
C
T
G
A
Genes: JJJJJJHJJJB

Composition

Border Collie
82%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality +14 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Border Collie
Head Border Collie
Ears Border Collie
Snout Rottweiler
Mouth Border Collie
Nose Border Collie
Eyes Border Collie
Color St. Bernard