Legolas Leather Bitcoin Dog - Mix of Border Collie, Schnauzer, Husky, Pug, Dachshund, Maltese, Golder Retriever and Grey Wolf

Achievements

Racer
Legolas Leather
How you doin? ;) Legolas Leather here. Shy dogs that tuck tail bore me. I love hiding my human's shoes. I have a pretty nice collection of old, stinky sneakers. I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 8%
  • Age 38 months
  • Racing Exp 12
  • Border Collie 27%
  • 2 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 2
 Best Time16.48 sec
No rank  Racing *** Pts
100.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGAAATATACATAGGAACCAGATACTACCCC
A
C
A
G
A
A
A
T
A
T
A
C
A
T
A
G
G
A
A
C
C
A
G
A
T
A
C
T
A
C
C
C
C
Genes: 42CJCAK8JJL

Composition

Border Collie
27%
Schnauzer
18%
Husky
9%
Pug
9%
Dachshund
9%
Maltese
9%
Golder Retriever
9%
Grey Wolf
9%

Current Energy

Vitality -21 points
Lunar Effect -18 points

Traits Breakdown

Body Husky
Tail Pug
Legs Schnauzer
Front Legs Border Collie
Head Schnauzer
Ears Dachshund
Snout Maltese
Mouth Golder Retriever
Nose Border Collie
Eyes Border Collie
Color Grey Wolf