Mandy Maria Litecoin Dog - Mix of Border Collie, Shiba Inu, Pug, Dachshund, Maltese, Golder Retriever and Beagle

Achievements

None
Mandy Maria
What's up, pup? Name's Mandy Maria. Bones I let age in the dirt develop my favorite flavor, but I don't recommend that with Oreos. I love unconditionally. I slept with a cat and I liked it. As long as we are headed in the same direction, I say we try hanging out for a while.
  • Purity 14%
  • Age 40 months
  • Racing Exp 0
  • Border Collie 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAGAAGTATACTACGGAACCAGATACTACCTA
G
T
A
G
A
A
G
T
A
T
A
C
T
A
C
G
G
A
A
C
C
A
G
A
T
A
C
T
A
C
C
T
A
Genes: E2EJJAK8JJD

Composition

Border Collie
36%
Shiba Inu
18%
Pug
9%
Dachshund
9%
Maltese
9%
Golder Retriever
9%
Beagle
9%

Current Energy

Vitality -11 points
Lunar Effect -4 points

Traits Breakdown

Body Shiba Inu
Tail Pug
Legs Shiba Inu
Front Legs Border Collie
Head Border Collie
Ears Dachshund
Snout Maltese
Mouth Golder Retriever
Nose Border Collie
Eyes Border Collie
Color Beagle