Adelaide Alvin Digital Cryptocurrency Dog - Mix of Border Collie, Husky, Rottweiler, Corgi and St. Bernard

Achievements

Pro Racer
Adelaide Alvin
I'm Adelaide Alvin and I'd like to show you a trick or two. I like to respond to sad puppy eyes with sad puppy eyes of my own. I wish I never had to go to the vet's office. They are friendly enough, but it smells funny there. Being able to lick myself is nice, but I want to find my special someone.
  • Purity 38%
  • Age 38 months
  • Racing Exp 75
  • Border Collie 64%
  • 16 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

16 races   |
  • 7 0 2
 Best Time15.77 sec
Rank 71  Racing *** Pts
56.3 % wins (9) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTACTACACATACTACCACTACTACAGCTGA
T
A
C
T
A
C
T
A
C
A
C
A
T
A
C
T
A
C
C
A
C
T
A
C
T
A
C
A
G
C
T
G
A
Genes: JJJ4JJHJJOB

Composition

Border Collie
64%
Husky
9%
Rottweiler
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -1 points
Lunar Effect 0 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Husky
Head Border Collie
Ears Border Collie
Snout Rottweiler
Mouth Border Collie
Nose Border Collie
Eyes Corgi
Color St. Bernard