Aggie Abigail Cryptocurrency Dog - Mix of Border Collie, Husky, Rottweiler, Schnauzer and Dachshund

Achievements

Podium Champion
Speed Champion
Pro Racer
Master Champion
Aggie Abigail
Pleased to meet you! My name's Aggie Abigail. I'm into recreational spankings and a little 'ruff' play. I hate being left alone all day. My favorite position is doggie style ;) I'll eat my vomit and yours too. If you are looking for companionship without commitment, so am I.
  • Purity 38%
  • Age 41 months
  • Racing Exp 177
  • Border Collie 64%
  • 49 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 6 11 4
49 races    Best Time13.50 sec
Rank 65  Racing *** Coins
42.9 % wins (21) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TACTACTACACATACTACCACATATACGGATAC
T
A
C
T
A
C
T
A
C
A
C
A
T
A
C
T
A
C
C
A
C
A
T
A
T
A
C
G
G
A
T
A
C
Genes: JJJ4JJHCJAJ

Composition

Border Collie
64%
Husky
9%
Rottweiler
9%
Schnauzer
9%
Dachshund
9%

Current Energy

Vitality -1 points
Lunar Effect +4 points

Traits Breakdown

Body Border Collie
Tail Border Collie
Legs Border Collie
Front Legs Husky
Head Border Collie
Ears Border Collie
Snout Rottweiler
Mouth Schnauzer
Nose Border Collie
Eyes Dachshund
Color Border Collie