Muffy Marky Mark Cryptocurrency Dog - Mix of German Shepard, Husky, Border Collie, Labrador BK, Pug, Shiba Inu and Schnauzer

Achievements

Podium Champion
Pro Racer
Master Champion
Speed Champion
Muffy Marky Mark
I've been known to take mega bytes when playing ruff. I like it when you're frisky. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Trust me. Leashes, collar and whips can be fun if you know what you're doing.
  • Purity 9%
  • Age 40 months
  • Racing Exp 157
  • German Shepard 27%
  • 35 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 8 6 6
35 races    Best Time13.78 sec
No rank  Racing *** Coins
57.1 % wins (20) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAACATCAACATACGAAGTAATATACTCATCA
G
C
A
A
C
A
T
C
A
A
C
A
T
A
C
G
A
A
G
T
A
A
T
A
T
A
C
T
C
A
T
C
A
Genes: 6474J2ECJ77

Composition

German Shepard
27%
Husky
18%
Border Collie
18%
Labrador BK
9%
Pug
9%
Shiba Inu
9%
Schnauzer
9%

Current Energy

Vitality -5 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs German Shepard
Front Legs Husky
Head Border Collie
Ears Pug
Snout Shiba Inu
Mouth Schnauzer
Nose Border Collie
Eyes German Shepard
Color German Shepard