Crush Casper Crypto Dog - Mix of Grey Wolf, German Shepard, Husky, Border Collie, Pug, Rottweiler, Schnauzer, French Bulldog and St. Bernard

Achievements

Racer
Crush Casper
Yo! I'm Crush Casper and I'd like to rock your world. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! If you are looking for companionship without commitment, keep looking.
  • Purity 5%
  • Age 41 months
  • Racing Exp 17
  • Grey Wolf 18%
  • 7 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 2
7 races    Best Time14.82 sec
No rank  Racing *** Coins
28.6 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCCCTCAACATACGAACACATATCACGATGA
C
C
C
C
C
C
T
C
A
A
C
A
T
A
C
G
A
A
C
A
C
A
T
A
T
C
A
C
G
A
T
G
A
Genes: LL74J2HC79B

Composition

Grey Wolf
18%
German Shepard
18%
Husky
9%
Border Collie
9%
Pug
9%
Rottweiler
9%
Schnauzer
9%
French Bulldog
9%
St. Bernard
9%

Current Energy

Vitality +3 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs German Shepard
Front Legs Husky
Head Border Collie
Ears Pug
Snout Rottweiler
Mouth Schnauzer
Nose German Shepard
Eyes French Bulldog
Color St. Bernard