Quan Chi Quarterback Litecoin Dog - Mix of Corgi, French Bulldog, Maltese, Dachshund, Pug, Schnauzer, Husky, St. Bernard and Golder Retriever

Achievements

Racer
Quan Chi Quarterback
I've been known to take mega bytes when playing ruff. I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! Trust me. Leashes, collar and whips can be fun if you know what you're doing. Don't bother contacting me if you like cats.
  • Purity 5%
  • Age 40 months
  • Racing Exp 1
  • Corgi 18%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time15.38 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCACCCGACGAGGAGAAAGCATAACATGAAGA
A
G
C
A
C
C
C
G
A
C
G
A
G
G
A
G
A
A
A
G
C
A
T
A
A
C
A
T
G
A
A
G
A
Genes: OK99A2OC4B8

Composition

Corgi
18%
French Bulldog
18%
Maltese
9%
Dachshund
9%
Pug
9%
Schnauzer
9%
Husky
9%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -45 points
Lunar Effect -2 points

Traits Breakdown

Body Corgi
Tail Maltese
Legs French Bulldog
Front Legs French Bulldog
Head Dachshund
Ears Pug
Snout Corgi
Mouth Schnauzer
Nose Husky
Eyes St. Bernard
Color Golder Retriever