Doc Dawson Digital Cryptocurrency Dog - Mix of French Bulldog, Maltese, Pug, Corgi, Boxer and St. Bernard

Achievements

None
Doc Dawson
Hey! My name's Doc Dawson! I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! If you enjoy growling through fences as much as I do, we should get together.
  • Purity 27%
  • Age 41 months
  • Racing Exp 0
  • French Bulldog 55%
  • 0 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAACCCGACGACGAGAAAGCAACCGATGACGA
C
G
A
A
C
C
C
G
A
C
G
A
C
G
A
G
A
A
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 9K9992OG9B9

Composition

French Bulldog
55%
Maltese
9%
Pug
9%
Corgi
9%
Boxer
9%
St. Bernard
9%

Current Energy

Vitality -45 points
Lunar Effect -6 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs French Bulldog
Front Legs French Bulldog
Head French Bulldog
Ears Pug
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog