Legolas Louie Litecoin Game Dog - Mix of French Bulldog, Boxer, Maltese, Rottweiler, Corgi and St. Bernard

Achievements

None
Legolas Louie
My favorite pastime is playing tug-of-war with my human's underwear. Watching kids play without me is the worst, no? I'm willing to try little bondage, so my human chained me up! I love unconditionally. New experiences? New treats? New places! Yes, please!
  • Purity 18%
  • Age 40 months
  • Racing Exp 0
  • French Bulldog 45%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAACCCGACACCGAAACAGCAACCGATGACGA
C
G
A
A
C
C
C
G
A
C
A
C
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: 9K9H9GOG9B9

Composition

French Bulldog
45%
Boxer
18%
Maltese
9%
Rottweiler
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -40 points
Lunar Effect 0 points

Traits Breakdown

Body French Bulldog
Tail Maltese
Legs French Bulldog
Front Legs Rottweiler
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog