Nori Nugget Crypto Dog - Mix of French Bulldog, Corgi, Boxer, Maltese, Border Collie, Rottweiler and St. Bernard

Achievements

Racer
Nori Nugget
I answer to 'Nori Nugget'. Someday I'm gonna breakout from inside this server. I am a proud show dog. I like showing off my perfect coat! I'm into leather...if I have the right partner. If you are tall enough to reach the door handle, I 'specially wanna meet you.
  • Purity 7%
  • Age 40 months
  • Racing Exp 1
  • French Bulldog 27%
  • 1 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.95 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGCACCTACCACCGAAACAGCAACCGATGACGA
A
G
C
A
C
C
T
A
C
C
A
C
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
G
A
C
G
A
Genes: OKJH9GOG9B9

Composition

French Bulldog
27%
Corgi
18%
Boxer
18%
Maltese
9%
Border Collie
9%
Rottweiler
9%
St. Bernard
9%

Current Energy

Vitality -25 points
Lunar Effect 0 points

Traits Breakdown

Body Corgi
Tail Maltese
Legs Border Collie
Front Legs Rottweiler
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes St. Bernard
Color French Bulldog