Pasha Pearl Digital Cryptocurrency Game Dog - Mix of Border Collie, French Bulldog, Boxer, Beagle, Rottweiler and Corgi

Achievements

Racer
Pasha Pearl
Pasha Pearl is the name, love is my game. And fetch of course... Once I caught a seagull, but it scared me so I let it go. I hate hiding under the bed during a thunder storm but that's just smart, right? I'm looking for a hard-working service animal who can keep up with me.
  • Purity 12%
  • Age 41 months
  • Racing Exp 10
  • Border Collie 27%
  • 5 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
5 races    Best Time14.35 sec
No rank  Racing *** Coins
20.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATACTACCACCGAAACAGCAACCGATACCGA
C
T
A
T
A
C
T
A
C
C
A
C
C
G
A
A
A
C
A
G
C
A
A
C
C
G
A
T
A
C
C
G
A
Genes: DJJH9GOG9J9

Composition

Border Collie
27%
French Bulldog
27%
Boxer
18%
Beagle
9%
Rottweiler
9%
Corgi
9%

Current Energy

Vitality -25 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail Border Collie
Legs Border Collie
Front Legs Rottweiler
Head French Bulldog
Ears Boxer
Snout Corgi
Mouth Boxer
Nose French Bulldog
Eyes Border Collie
Color French Bulldog